Wikia

Conlang

Tetral

3,217articles on
this wiki
Talk1


The author requests that you do not make significant changes to this project without first seeking approval.
By all means, please either help fix spelling, grammar and organization problems or contact the author about them. Thank you.
The author wishes to make it clear this project is currently undergoing significant construction or revamp.
By all means, take a look around. Thank you.


Progress 74%


Name: tetral

Type: Logical language, Artistic language

Alignment: direct

Head Direction: Sinusoid

Number of genders: 1

Declensions: No

Conjugations: No

Nouns declined
according to
Case Number
Definitiveness Gender
Verbs conjugated
according to
Voice Mood
Person Number
Tense Aspect

tetral is an artistic language designed to be used by cyborgs and robots in science-fiction stories. Therefore, it is also highly logical, in order to sound very computer-like. The language is designed around a base 4 numeral system.

PhonologyEdit

tetral name originates from the amount of symbols in its basic system: four. These symbols correspond to four figures (0, 1, 2 and 3), and have several ways of being represented - either on paper, orally, or any by any mean to represent a base-4 number. This is a big advantage of tetral : you can commumicate either by speaking, writing, sending smoke signals, slapping on the wrists ...

Another advantage of this system is that it is easily encoded on a computer, since a computer can only encode numbers (there is a one-to-one mapping between base-4 numbers with one figure and binary numbers with two figures). Hence, tetral text is very compact on a computer.

In this document, we will use the sword writing system The sword alphabet represent 0 as a vertical bar, 1 as slash, 2 as a backslash and 3 as a dot centered in height. Here is the table :

0 1 2 3
Sword-00 Sword-10 Sword-01 Sword-11

tetral figures are usually put together in group of 3 called codons. The codons are the actual basic units in grammar. Let's just glimpse a bit in it, and note that there is two types of codons : the structural codons are codons composed of three times the same figure, the regular codons are the 60 others.

In the sword writing system, the three figures constituing codon are written vertically (downwards), wheras sequence of codons is written horizontally (from left to right), albeit the direction of text and codon may vary from a document to another one. Let's just give a sample of text written with the sword alphabet.

001321311103000032103213032133

Its numeric table is

The fellowing example shows another alphabet based on the same principle, but with different symbol for figures, which are more suited to be printed with a stamp. Little translation or rotation of a character does not affect its meaning, therefore it is very easy to write tetral manually with stamps.

AACTGCTCCCATAAAATGCATGCTATGCTT

GrammarEdit

Word typesEdit

Regular wordsEdit

These words are written with the sixty codons that contains at least two differents figures. There is no further subclassification on their role. For instance, 031021 can be translatted either as the adjective "large", the verb "enlarge" or the nominal expression "a large object" depending on the context it is used with.

If you know a bit of lojban, notice that there is no clear distinction such as selbri (relation word) and sumti (argument word) in tetral. In tetral every word can be used as an argument or a relation or both. (Though the distinction seems at bit blurrier in Lojban than what I explained) A regular word just carry its meaning, and have nothing implied with the sentence structure. So, in tetral, the link between a word and one of its parameter is not encoded in the relation word (In Lojban, every selbri defines what each argument means based on their position in the sentence).


Example Tree : 302302


Structural wordsEdit

These words are written with the three codons 111, 222 and 333. They do not carry any meaning (or almost none). The list of structural words is very confined, but half of these words are the most used ones, since they are use to structure the sentences.

Word Latin Role
111333 ( Open list of parameters
333111 ) Close list of parameters
111 Quick parameter
222333 [ Open collection
333222 ] Close collection
333  : Relationnal connector
333333 = Assign variables and macros
111111111 / Close all
222111 < language level up/ open extended directive
111222 > language level down/ close extended directive
222222222  ! reset


The blank worldEdit

This word is written 000. It is used to separe other types of words. Its role is similar the latin space, but is translated by a comma (,) in latin form. The blank word between two words is sometimes mendatory, sometimes facultative.

  • You must use it between two regular words or two structural words.
  • You shouldn't use it between a regular word and a structural word.
  • The first rule can be eluded between two closure structural word ( 333111 or 333222 ) words.


Sentence structureEdit

Sentences are articulated as arborescences where a node corresponds to a word and its children correspond to its qualifiers or the words it refers to.

Computer science terminology will be reused here. The topmost word is called the root. The depth of a word (or node) is its distance from the root. Put in another way, the root have a depth equals to 0 and every other nodes have the depth of their parent plus one.

The height of an arborescence (or sentence) is the maximal depth of the nodes composing it.

ParametersEdit

Parameters are words used to refine the meaning of an other word, like adjectives and relative propositions do in English. For example red colour refines the meaning of apple. The parameters of a word a given in the parameter list, right after the word they are supposed to modify. The parameter list begins with 112333 and ends with 333111. Structure : X1x111333X2x333111

Example : A red apple

The meaning of a word can only be modified through its parameters.

LinksEdit

A link word is a word changes the meaning of the relation between a word and one of its parameter. The link is put in front of the parameter it applies to, and is separed from it with 333. When a parameter has no given relation, a "to be" relation is assumed i.e. the parent word is also one the entity given by the parameter. An explicit relation changes this meaning.

A link word can be any kind of word, but a small set of word are used in 80% of cases.

structure : X1x111333X2x333X3x333111

Example : I'm looking at you X1x111333133333X2x000031333X3x333111

Note : 031 means "owned by". In the case of an action, the owner should be understood as the subject of the action. Similary, 133 means "owns" and refers to the direct object in when relating with an action.

A link can have it own parameters itself, although this is usually used in very specific cases as it can make the sentence unclear. The most common exemple is to specify wether a link applies only at the beginning or the end of an action. Example : to come from home. X1x111333220111333003333111000333X2x

Note : Since origin of a place is often used (in motion verb for instance), there exists the word 332113 that means 220111333003333111 on its own.

CollectionsEdit

In every languages it is common you have to refer to several entities with the same properties or actions. One obvious solution is to repeat the properties to each entity, but this is cumbersome. English skips repetion by allowing to stack different subjects before the verb (the last word separated by and). In tetral you cannot stack words one after the other to group them. Indeed such stacking just enumerate words and any parameters put after would apply only to the last of them. Remember : there relations are only between a parent word and its children. Tetral add a new concept, a collection wich basically allows us to group various entities. Collections can group word entities to give them the same parameters. But it is stronger than that. It can group several parameters and give them the same link with their parents as it can group several links and give them the same parameter.

A collection is started with the codon 222333 and ends with codon 333222.

Examples :

green apples, melons and pears. (Each of them are individually green.)

Looking at an apple and a melon. (Looking one after the other, or a the same time, ... The order is unspecified.)

Looking at myself.

Please note that nothing prevents a word from having its own parameters list inside a group. You can also also nest groups but it sounds a bit weird and its usage is strongly discouraged when uneeded. I may be justified when you have very specific parametrisation of word in a large collection. Like in the following example, where X3x is a parameter applied to two entities, and X5x is a parameter applied the the three entities. 222333000222333X1x000X2x333222111333X3x333111X4x333222111333X5x333111

A collection is sometimes referred as collection list, to remember it is written down as a list like the parameters list.

Variables and macrosEdit

VariablesEdit

MacrosEdit

Flow controlEdit

ClosureEdit

Some sentences are very huge arborescence that can go deep. Some conveniance tools and some good practise is needed to keep track of opened lists. The first good practise is obviously to avoid to build large height tree.

As this is not always possible to reduce height and the height of the tree is hardly predictable before saying it, there is a second good practise : add useless blank word after the opening and before the closing of a depth-4 list (or at a multiple of 4 depth).

222333X1x111333X1x111333X1x111333000000X1x111333X1x333111000000333111X1x333111X1x333111X1x222333111333X1x333111

222333X1x111333X1x111333X1x111333X1x111333X1x333111333111X1x333111X1x333111X1x222333111333X1x333111

But the previous exemple has something special more. It use the pattern X1x111333X2x333111 with one parameter nested several times. This grows up the depth of the tree as fast as adding meaningfull words. This is innefficient. Hence, a new connector, which like the relation connector, do not growths the depth is added. It is 111. It is a simple shortcut to a one-word parameter list. X1x111X4x is equivalent to X1x111333X4x333111. Please do not mistake this shorcut with a relation. A relation specify the link between two words, and 111 is used to actually links the two words. 111 can be used with relations, though. X1x111X2x333X3x is equivalent to X1x111333X2x333X3x333111. Do not mistake with X1x333X2x111X3x, wich is a parameter X2x111333X3x333111 linked to its parent by the relation X1x. Note also that X1x111X2x333X3x can never mean X1x111333X2x333111000333X3x.


ExceptionsEdit

InterruptsEdit

Other grammatical aspectsEdit

Logical conjonctionsEdit

Dual and NegativeEdit

QuestionsEdit

Virtual form and ConditionalEdit

Variable-length wordsEdit

VocabularyEdit

Alphabet and syllaberiesEdit

swordEdit

001 002 003 010 011 012 013 020 021 022 023 030 031 032 033
100 101 102 103 110 112 113 120 121 122 123 130 131 032 133
200 201 202 203 210 211 212 213 220 221 223 230 231 032 233
300 301 302 303 310 311 312 313 320 321 322 323 330 331 032

padEdit

arrowsEdit

hooksEdit

arabEdit

001 002 003 010 011 012 013 020 021 022 023 030 031 032 033
100 101 102 103 110 112 113 120 121 122 123 130 131 032 133
200 201 202 203 210 211 212 213 220 221 223 230 231 032 233
300 301 302 303 310 311 312 313 320 321 322 323 330 331 032

latinEdit

Logical conjonctionsEdit

NumeralsEdit

Common connectorsEdit

Common variable identifiersEdit

Example : BabelEdit

Around Wikia's network

Random Wiki